**2013 Fall UCSD Transfer Decisions Thread **

<p>UC GPA:3.89
Major Pre-reqs Completed (Y/N):N(missing Calc 2/ Physics sequence)
Intended Major: Human Bio (Warren)
TAG?:Yes
IGETC?:Yes</p>

<p>Extracurriculars (clubs, leadership, volunteer, work):Hospital internship, work full time
Additional Details:
Applied for Financial Aid?:No
State (if domestic applicant):CA
Country (if international applicant):
Ethnicity:W
Gender:M
Estimated Family Contribution(EFC)/Income Bracket:Too high for FAFSA, too low
to help D:
Attending Transfer Admit Day? (if admitted):Yep!</p>

<p>Why you think you were accepted/waitlisted/rejected (strengths/weaknesses): GPA and TAG most likely. (Housing trick worked in my case btw)</p>

<p>Decision: Accepted
Major: Philosophy
GPA: They calculated it at a 3.43</p>

<p>Does each UC campus calculate GPA’s differently? I had some credits from out of state that they counted but didn’t replace a grade I made up for obviously- an F to an A grade. Hopefully Berkeley and UCLA calculate my GPA differently than they did and actually replace the grade I made up. What do you guys think?</p>

<p>@ aharrold</p>

<p>It’s not cool to dominate the thread by reposting. Relax, and enjoy the fact that you got in. If you want to know the answer to your question, visit a chance me thread.</p>

<p>Decision: Accepted
3/25 12pm</p>

<p>UC GPA: 3.7
Major Pre-reqs Completed (Y/N): No, I’m missing like 50, ok like 2
Intended Major: human biology, revelle college! my first choice :))))
TAG?: yes
IGETC?: yes</p>

<p>Extracurriculars (clubs, leadership, volunteer, work):

  • Summer internship at Big Wildlife (2011)
  • Summer research internship at UCSF Division of Gastroenterology(2012)
    -Summer research internship at UC Berkeley MCB dept. (2013)
  • Teacher Assistant/ Lab Assistant for Bio 1A and Bio1B professor
  • Volunteer at Emergency Dept. for private hospital
  • Volunteer at a lab for UC Berkeley’s College and Natural Resource
  • Volunteer at a Senior citizen home
  • Volunteer at Lawrence Hall of Science
  • Volunteer of YMCA</p>

<p>Additional Details: first generation,
Applied for Financial Aid?: yes
State (if domestic applicant): cali
Country (if international applicant):
Ethnicity: pacific islander/filipino
Gender: female
Estimated Family Contribution(EFC)/Income Bracket: 70k
Attending Transfer Admit Day? (if admitted): maybe, we’ll see what berkeley says</p>

<p>Why you think you were accepted/waitlisted/rejected (strengths/weaknesses):
TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG :smiley: :D</p>

<p>NOTE: I got the “good” housing message. So yah, if u get it, lets just say its not a bad thing!</p>

<p>ACCEPTED</p>

<p>UC GPA: 3.79
Major Pre-reqs Completed (Y/N): missing 3rd semester of physics
Intended Major: aerospace engineering
TAG?: No
IGETC?: No</p>

<p>Extracurriculars (clubs, leadership, volunteer, work): PTK, one part-time job, that’s about it…
Additional Details:
Applied for Financial Aid?: Yes
State (if domestic applicant): CA
Country (if international applicant):
Ethnicity: hispanic
Gender: F
Attending Transfer Admit Day? (if admitted): not sure</p>

<p>Why you think you were accepted/waitlisted/rejected (strengths/weaknesses): good GPA, A’s in all major related courses</p>

<p>@ Sarah989</p>

<p>YAY, you got in!!! Plus, your hispanic like me. What college? I’m in Warren</p>

<p>ACCEPTED TODAY!!! OMG
UC GPA: 3.67
Major Pre-reqs Completed: Missing Ochem 2 which is planned for summer.
Intended Major: General Biology (Warren)
TAG?:No
IGETC?:Yes</p>

<p>Extracurriculars: A lot
Applied for Financial Aid?:Yes
State (if domestic applicant):CA
Country (if international applicant):
Ethnicity:W
Gender:F
Estimated Family Contribution(EFC)/Income Bracket: $17,000
Attending Transfer Admit Day? (if admitted):Maybe!</p>

<p>Why you think you were accepted/waitlisted/rejected (strengths/weaknesses): I think my GPA and possibly well-roundedness.</p>

<p>For those who are curious, the financial aid trick worked for me! I didn’t trying housing though. I didn’t get the UCSD invite on Facebook but I think that’s because my Facebook account is linked to an email other than the one provided on my UC app.</p>

<p>Very happy, can’t stop smiling :slight_smile: Warren was my first choice, however I wish I had put Muir now.</p>

<p>@ Sarah989</p>

<p>YAY, you got in!!! Plus, your hispanic like me. What college? I’m in Warren</p>

<p>@ BioToUcla</p>

<p>CONGRATULATIONS!!! I’m in Warren too, Sociology, but changing to Sociology, Law and Society</p>

<p>Lol chill out, I didn’t know my first post went live because my wifi signal was lost. I had reported to the forum to take down that first post before I even saw your post. Instead of trying to be the board police why don’t you give your input?</p>

<p>Omg yayy congrats to you too!!! I’m beyond excited, this gives me higher hopes for LA tomorrow :smiley: honestly I don’t know much about Warren, I just chose the order for the colleges randomly I didn’t think it mattered haha!</p>

<p>^ lol. @aharrold where do you even see your GPA for UCSD? I’m curious what mine is with them; sorry I don’t know the answer to your question.</p>

<p>@SBvett of course! We’ve been through this from the beginning together! The UCLA tricks change for someeee people; I have nothing showing the way it should to be considered “good”, and it hasn’t changed. No matter, I never had a UCSD trick work, and yet I was accepted!</p>

<p>I called them and asked what my GPA was that they totaled up from my out of state units and CC units. It seemed like a lot of work for the admissions lady to do on the phone, so I wouldn’t ask unless you are REALLY curious haha.</p>

<p>@ aharrold</p>

<p>HAHAHA! I think I prefer to be called, Inspector!</p>

<p>haha @aharrold I’m not that curious at all :), but good to know I’m not missing some obvious link on my triton link or something…</p>

<p>@ BioToUcla</p>

<p>I think you will love Warren, if I’m not mistaken a lot engineers pick it. Revelle was my LAST choice.</p>

<p>No worries UCdrone, good luck to all of you on your applications! Crossing my fingers for Cal tomorrow, hopefully they add the GPA up differently considering I thought I had a 3.73!</p>

<p>ACCEPTED 4/25 </p>

<p>UC GPA:3.52
Major Pre-reqs Completed (Y/N): IP (missing Calc 2)
Intended Major: Economics
TAG?:NO
IGETC?:Yes (Fall 2012)</p>

<p>College: Marshall
Transfer admit day? Maybe :slight_smile: </p>

<p>Honestly, I think it’s unlikely I will go here but I am really honored. So happy! I hope this doesn’t bring up my hopes too much for tomorrow (Berkeley -__-) …</p>

<p>@ aharrold</p>

<p>Yes, but you had out of state units, right? That could throw anyone off, are you waiting for UCLA and Cal?</p>

<p>Yup! Hopefully my GPA is added up differently, but those grades are like 6 years old and I have a STRONG upward grade trend- only 4.0’s the past three semesters.</p>